L’histoire naturelle de l’infection grippale chez les hôtes sévèrement immunodéprimés vs non immunocompromis

Introduction Les avancées médicales ont entraîné une augmentation de la population mondiale d’immunodéprimés Les patients les plus sévèrement immunodéprimés sont ceux chez lesquels on a diagnostiqué une malignité hématologique, une tumeur d’organe solide ou qui ont d’autres conditions nécessitant des thérapies immunosuppressives et / ou transplantation de cellules souchesMatériaux et méthodes Les patients médicalement assistés avec un diagnostic clinique positif de la grippe ont été recrutés prospectivement et cliniquement évalués. Les prélèvements nasaux et le sérum ont été recueillis Évaluation de l’excrétion virale, cytokines nasales et sériques, maladie clinique et résultats cliniques pour comparer les personnes immunodéprimées Personnes immunodéprimées ayant une infection grippaleRésultats Les patients immunodéprimés atteints de la grippe présentaient une maladie / des complications plus graves, une élimination virale plus longue et une plus grande résistance antivirale tout en présentant moins de symptômes cliniques et de signes lors de l’évaluation clinique. Les patients immunodéprimés risquent de contracter une maladie grippale plus grave ou compliquée, ce qui peut être difficile à prévenir avec les vaccins existants et les traitements antiviraux. Les problèmes spécifiques à prendre en compte lors de la prise en charge d’un hôte sévèrement immunodéprimé comprennent le développement d’une excrétion asymptomatique. thérapie, et le risque potentiel élevé d’implication pulmonaireEnregistrement des essais cliniques, identifiant ClinicalTrialsgov NCT

Grippe A, influenza, hôte immunocompromis, greffe de cellules souches Au cours du dernier demi-siècle, les progrès de la médecine ont entraîné une augmentation de la population mondiale d’immunodépresseurs, y compris ceux recevant des immunosuppresseurs tels que le million dans le monde. virus de l’immunodéficience VIH et sida , et individus vivant plus longtemps avec l’une des immunodéficiences primaires connues Les plus sévèrement immunodéprimés sont ceux qui ont reçu un diagnostic de tumeur maligne hématologique, de tumeur solide ou qui reçoivent d’autres traitements immunosuppresseurs tels que la chimiothérapie et / ou greffes d’organes ou de cellules souches Chaque année, les individus reçoivent des greffes d’organes solides SOT dans le monde et plus qu’avec des malignités hématologiques et d’autres maladies sont traitées par greffe de cellules souches hématopoïétiques chaque année , laissant la plupart de ces patients immunodéprimés. plus grand n Les études épidémiologiques ont montré qu’une immunosuppression sévère est une comorbidité majeure qui place les individus à un risque plus élevé de morbidité et de mortalité graves en raison de l’importance de l’immunosuppression chez les personnes immunodéprimées. Les patients atteints du SIDA ont une durée de maladie accrue due à la grippe et une incidence plus élevée de pneumonie conduisant à une mortalité accrue Une étude des patients hospitalisés atteints de leucémie et de grippe a rapporté% de pneumonie et% de mortalité. De même, dans une grande étude rétrospective des receveurs de HSCT,% de tous les patients ont développé une infection grippale et% ont développé une pneumonie. Une étude plus récente des patients HSCT a démontré que jusqu’à% développé une pneumonie après une infection grippale avec une mortalité allant jusqu’à Dans SOT, les épidémies nosocomiales et les complications sévères de la grippe comme la myocardite et la pneumonie sévère Des études multicentriques sur l’infection à AHNpdm chez des receveurs SOT ont rapporté que% -% des individus infectés développaient une pneumonie,% -% nécessitaient des soins intensifs, avec une mortalité aussi élevée que% La grippe après SOT entraîne une morbidité plus élevée et taux de mortalité , avec des taux accrus de pneumonie grippale après transplantation pulmonaire, et un taux de mortalité ≥% observé chez les receveurs de SOT infectés par la grippe En plus de l’augmentation de la morbidité et de la mortalité, les patients sévèrement immunodéprimés montrent une excrétion prolongée de la grippe Ceci a été associé à l’évolution virale intrahostale, y compris la dérive antigénique dans un hôte immunosupprimé unique , le développement de la résistance antivirale après la thérapie [, -,], et co-infection simultanée avec des sous-types de grippe programmes de vaccination rigoureux et pharmacothérapie améliorée ont diminué l’impact de la grippe sur la population générale; Cependant, la grippe reste une menace sérieuse pour les personnes gravement immunodéprimées. La pandémie rappelle que les stratégies actuelles de vaccination et la pharmacothérapie actuelle ne permettent toujours pas de prévenir et d’atténuer la maladie chez les personnes immunodéprimées. L’objectif principal de cette étude était de comparer antécédents d’infection grippale chez les sujets immunocompromis sévèrement non immunodéprimés. Un examen soigneux des symptômes et des signes d’infection, des mesures virologiques, des études immunologiques et des paramètres cliniques ont été réalisés pour étudier la pathogenèse naturelle de la grippe dans ce groupe d’hôtes sévèrement immunodéprimés cellulite.

MATÉRIAUX ET MÉTHODES

Protocole clinique

Les sujets ont été recrutés au NIH Clinical Center à Bethesda, MD, et Washington Hospital Center à Washington, DC, sous un protocole approuvé par la CISR “Influenza chez les hôtes immunodéprimés et immunodéprimés” Identificateur Clinicaltrialsgov NCT Tous les participants ou le tuteur légal ont signé le consentement éclairé Les patients médicalement assistés avec un diagnostic de grippe ont été recrutés. Les antécédents médicaux et physiques ont été réalisés, les prélèvements diagnostiques initiaux ont été recueillis et les prélèvements nasaux et les prélèvements sanguins ont été effectués tous les jours pendant les premiers jours postdiagnostic. Les sujets qui excrètent le virus pendant une période prolongée ont été suivis tout au long de leur infection et l’échantillonnage a été effectué jusqu’à ce que l’infection soit résolue. Les données cliniques ont été compilées et des analyses statistiques ont été effectuées à l’aide de GraphPad Prism. doux ware

Isolement viral et identification

D’autres échantillons ont été testés à l’aide d’un test RT-PCR en temps réel en une étape de polymérisation en chaîne par polymérase Taqman en une seule étape, tel que décrit ailleurs et / ou le Luminex Multiplex Respiratory. Kit virale Panel Luminex Corp Austin, TX Isolement viral utilisé méthodes de culture MDCK standard Type et sous-type ont été déterminées par RT-PCR et le séquençage des gènes hémagglutinine HA et neuraminidase NA et la comparaison avec des séquences connues de la grippe dans Genbank

Séquençage et identification du génotype

L’acide nucléique total a été extrait des échantillons à l’aide du système bioMérieux NucliSENS easyMAG L’ADN complémentaire de l’ADN viral a été transcrit en utilisant l’unim Primer spécifique de la grippe et la PCR a été réalisée en utilisant des amorces personnalisées pour amplifier les segments de gènes viraux.

Tableau amorces utilisées pour séquence virale Isolats Nom de la séquence saisonnière HN HA sHNHA-F AGCAAAAGCAGGGGATAA sHNHA-F GACCAAATCTTCCTGTATGCTCAA sHNHA-F ATCAAATCAATGGGAAGC sHNHA-R AAATGTTGCACCCTAATG sHNHA-R GTCCTCAACATATTTCTCAAG sHNHA-R ATGTCTCCCGGTTTTACTATTGTC saisonnière HN NA sHNNA-F AGCAAAAGCAGGAGTAA sHNNA-F CAGGAGTCAGAATGCGTTTGTATC sHNNA-R ATATAGGCATGAAGATTGA sHNNA-R TTTTCCCCTCCTCAATG sHNMP-F AAAAGCAGGTAGATATTGAAAGA AHNpdm HA HA-F GTAAAACGACGGCCAGAGGTTATCATGCGAACAATTCA HA-R CAGGAAACAGCTATGACCCTCACTTTGGGTCTTAT HA-F GTAAAACGACGGCCAGGGGCATTCACCATCCATCTACT HA-R CAGGAAACAGCTATGACTACCATCCATCTACCATCCCTGTC HA-F GTAAAACGACGGCCAGTAAAAAGCACAAAATTGAGACTGG HA-R CAGGAAACAGCTATGACCTTTACCCCATCTATTTCTTCTCT HA-F GTAAAACGACGGCCAGTATATGAAAAGGTAAGAAGC HA-R CAGGAAACAGCTATGACCATGCTTCTGAAATCCTAA AHNpdm NA NA-F GTAAAACGACGGCCAGATGAATCCAAACCAAAAG NA -R CAGGAAACAGCTATGACTACAGTAAAGCAAGAACCA NA-F GTAAAACGACGGCCAGATGGCATCAATTGGCTAACA NA-R CAGGAAACAGCTATGACTGTTAGCCAATTGATG CTAC NA-F GTAAAACGACGGCCAGTTCAAATACGGCAATGG NA-R CAGGAAACAGCTATGACCCATTGCCGTATTTGAA saisonnière HN HA sHNHA-F GTAAAACGACGGCCAGAGTAGCGAAAGCAGGGGAAAATA sHNHA-R CAGGAAACAGCTATGACTGAAGACACTACAGAAACATAAGC sHNHA-F GTAAAACGACGGCCAGCAAACAACAAAGAAAAAGAAGTCC sHNHA-R CAGGAAACAGCTATGACTTCACCTTGTTTGTAATCC sHNHA-F GTAAAACGACGGCCAGATGGTAGATGGTTGGTATGGTTAT sHNHA-R CAGGAAACAGCTATGACTTCTGAAATTCTGGTCTTA saisonnière HN NA sHNNA-F GTAAAACGACGGCCAGTAATGTTGCAAATAGGAAATA sHNNA-R CAGGAAACAGCTATGACTATTTTAGTACAGCCACAGC sHNNA-F GTAAAACGACGGCCAGAAAGTTCGAATCAGTTGC sHNNA-R CAGGAAACAGCTATGACATCACTGTCGGTATTTGTC sHNNA-F GTAAAACGACGGCCAGTCCGCGTCCCGAAGATG sHNNA-R CAGGAAACAGCTATGACCAATGGTGAACGGCAACT Nom de la séquence saisonnière HN HA sHNHA-F AGCAAAAGCAGGGGATAA sHNHA-F GACCAAATCTTCCTGTATGCTCAA sHNHA-F ATCAAATCAATGGGAAGC sHNHA-R AAATGTTGCACCCTAATG sHNHA-R GTCCTCAACATATTTCTCAAG sHNHA-R ATGTCTCCCGGTTTTACTATTGTC saisonnière HN NA sHNNA-F AGCAAAAGCAGGAGTAA sHNNA -F CAGGAGTCAGAATGCGTTTGTATC s HNNA-R ATATAGGCATGAAGATTGA sHNNA-R TTTTCCCCTCCTCAATG sHNMP-F AAAAGCAGGTAGATATTGAAAGA AHNpdm HA HA HA-F GTAAAACGACGGCCAGAGGTTATCATGCGAACAATTCA-R CAGGAAACAGCTATGACCCTCACTTTGGGTCTTAT HA-F GTAAAACGACGGCCAGGGGCATTCACCATCCATCTACT HA-HA-R CAGGAAACAGCTATGACTACCATCCATCTACCATCCCTGTC F GTAAAACGACGGCCAGTAAAAAGCACAAAATTGAGACTGG HA-HA-R CAGGAAACAGCTATGACCTTTACCCCATCTATTTCTTCTCT F GTAAAACGACGGCCAGTATATGAAAAGGTAAGAAGC HA-R CAGGAAACAGCTATGACCATGCTTCTGAAATCCTAA AHNpdm NA NA- F GTAAAACGACGGCCAGATGAATCCAAACCAAAAG NA-R CAGGAAACAGCTATGACTACAGTAAAGCAAGAACCA NA-F GTAAAACGACGGCCAGATGGCATCAATTGGCTAACA NA-R CAGGAAACAGCTATGACTGTTAGCCAATTGATGCCAT NA-F GTAAAACGACGGCCAGTTCAAATACGGCAATGG NA-R HN CAGGAAACAGCTATGACCCATTGCCGTATTTGAA saisonnière HA sHNHA-F GTAAAACGACGGCCAGAGTAGCGAAAGCAGGGGAAAATA sHNHA-R CAGGAAACAGCTATGACTGAAGACACTACAGAAACATAAGC sHNHA-F GTAAAACGACGGCCAGCAAACAACAAAGAAAAAGAAGTCC sHNHA-R CAGGAAACAGCTATGACTTCACCTTGTTTGTAATCC sHNHA-F GTAAAACGACGGCCAGATGGTAGATGGTTGGTATG GTTAT sHNHA-R CAGGAAACAGCTATGACTTCTGAAATTCTGGTCTTA saisonnière HN NA-F sHNNA GTAAAACGACGGCCAGTAATGTTGCAAATAGGAAATA sHNNA-R CAGGAAACAGCTATGACTATTTTAGTACAGCCACAGC sHNNA-F GTAAAACGACGGCCAGAAAGTTCGAATCAGTTGC sHNNA-R CAGGAAACAGCTATGACATCACTGTCGGTATTTGTC sHNNA-F GTAAAACGACGGCCAGTCCGCGTCCCGAAGATG sHNNA-R CAGGAAACAGCTATGACCAATGGTGAACGGCAACT Voir Grande

Tests immunologiques

Les cytokines de lavage sérique et nasale ont été mesurées en utilisant le test Bio-Plex Pro Human Cytokine -plex sur Bio-Rad Bio-Plex Bio-Rad Hercules, Ca Les cytokines suivantes ont été mesurées: interleukine β, interleukine, interleukine, interleukine, interleukine IL- interleukine, interleukine, interleukine, interleukine, interleukine, interleukine, interleukine, facteur stimulant les colonies de granulocytes G-CSF, facteur stimulant les colonies de granulocytes macrophages GM-CSF, interféron γ, protéine chimioattractive monocytaire MCP-, protéine inflammatoire des macrophages β MIP -β, et facteur de nécrose tumorale α TNF-α Les contrôles utilisés ont été recueillis chez des volontaires sains. Les résultats ont été compilés et une analyse statistique a été effectuée en utilisant le logiciel GraphPad Prism.

RÉSULTATS

Quatre-vingt-six patients grippaux ont été inclus sur une période d’un an entre et Parmi ceux-ci,% ont été classés comme sévèrement immunodéprimés, principalement en raison d’une tumeur maligne ou d’un traitement immunosuppresseur récent. Les autres patients ont été classés comme non immunocompromis. inclus les individus avec et sans comorbidités sous-jacentes Les caractéristiques démographiques de ces individus sont résumées dans le tableau

Tableau Données démographiques sur les patients Immunocompromised NonImmunocompromised Total Nombre de participants%% Sexe Masculin%%% Féminin%%% Âge, années & lt; %%% -%%% & gt; %%% Course Blanc%%% Noir%%% Asiatique%%% Hispanique%%% Multirace%%% BMI Sous-poids & lt; %%% Normal -%%% Obésité ≥%%% Obésité ≥%%% Tabagisme Consommation actuelle%%% Utilisation passée ≤ y avant%%% Aucune utilisation ou & gt; Y antérieur%%% Vacciné à l’intérieur y Vacciné%%% Non vacciné%%% Immunocompromised NonImmunocompromised Total Nombre de participants%% Sexe Masculin%%% Féminin%%% Âge, années & lt; %%% -%%% & gt; %%% Course Blanc%%% Noir%%% Asiatique%%% Hispanique%%% Multirace%%% BMI Sous-poids & lt; %%% Normal -%%% Obésité ≥%%% Obésité ≥%%% Tabagisme Consommation actuelle%%% Utilisation passée ≤ y avant%%% Aucune utilisation ou & gt; Y avant%%% Vacciné à l’intérieur y Vacciné%%% Non vacciné%%% Abréviation: IMC, indice de masse corporelleVoir Note importante,% des individus de l’étude avaient été vaccinés dans l’année suivant l’infection par la grippe Une majorité des individus non immunocompromis étaient Bien que la plupart des patients de l’étude étaient non-fumeurs,% des participants non immunodéprimés étaient des fumeurs actuels, alors qu’il n’y avait pas de fumeurs actuels dans le groupe immunodéprimé. Les maladies hématologiques étaient le diagnostic sous-jacent le plus courant% et% de patients avaient infection dans le groupe immunodéprimé La plupart avaient une forme de maladie du greffon contre l’hôte GVHD; Tableau Chez les patients du groupe non immunodéprimé,% présentaient des comorbidités chroniques, notamment une hypertension, un diabète sucré, une maladie coronarienne, un asthme ou une maladie pulmonaire obstructive chronique ou une infection par le VIH bien contrôlée

Tableau Conditions sous-jacentes du groupe immunodéprimé Transplantés totaux sans greffe% sans transplantation% Condition hématologique Myélome multiple Leucémie lymphoblastique aiguë Lymphome de Hodgkin Lymphome lymphocytaire périphérique Lymphome diffus à grandes cellules B Anémie aplasique grave Syndrome myélodysplasique Lymphome à cellules du manteau Leucémie myéloïde chronique Leucémie lymphoïde chronique Autres% sarcome d’Ewing Cancer rectal Mélanome métastatique Cancer du sein Immunocompromised Total Transplantation de cellules souches% Aucun transplant% Condition hématologique Myélome multiple Leucémie lymphoblastique aiguë Lymphome de Hodgkin Lymphome T à lymphocytes diffus Lymphome diffus à grandes cellules B Anémie aplasique sévère Syndrome myélodysplasique Lymphome à cellules du manteau Leucémie myéloïde chronique Leucémie lymphoïde chronique Autres% Ew Sarcome du rectum Cancer rectal Mélanome métastatique Cancer du sein View Large Une évaluation complète des symptômes au moment du diagnostic a été réalisée chez les patients Tableau Les symptômes les plus fréquents étaient: toux sèche, fièvre% et céphalée% Frissons, coryza, toux productive et sueurs également commun Une gamme d’autres symptômes ont été observés, y compris l’essoufflement et la douleur thoracique. L’intérêt était la prévalence de multiples symptômes gastro-intestinaux et neurologiques.

Tableau Symptômes cliniques Symptômes Immunodéprimés Pourcentage Non immunocompromis Pourcentage P Valeur ODDS RATIO Total Pourcentage Toux sèche%%% Fièvre%%% Maux de tête%%% Frissons%%% Coryza%%% Toux productive%%% Sueurs%%% Myalgie%%% Essoufflement de respiration%%% Mal de gorge%%% Douleur thoracique%%% Nausée%%% Arthralgie%%% Vomissement%%% Chémosis%%% Diarrhée%%% Symptômes neurologiques%%% Douleurs abdominales%%% Fatigue%%% Diminution de l’appétit %%% Éruption cutanée%%% Symptôme Immunodéprimé Pourcentage Non immunocompromis Pourcentage P Valeur ODDS RATIO Total Pourcentage Toux sèche%%% Fièvre%%% Maux de tête%%% Frissons%%% Cor Yza%%% Toux productive%%% Sueurs%%% Myalgie%%% Essoufflement%%% Mal de gorge%%% Douleur thoracique%%% Nausée%%% Arthralgie%%% Vomissement%%% Chémosis%%% Diarrhée %%% Symptômes neurologiques%%% Douleur abdominale%%% Fatigue%%% Diminution de l’appétit%%% Éruption cutanée%%% Les valeurs en gras indiquent une signification statistiqueView LargeLa majorité des symptômes étaient plus fréquents dans le groupe non immunodéprimé, y compris ceux qui étaient statistiquement plus élevés: toux sèche, frissons, sueurs, myalgie, essoufflement, chémosis, et symptômes neurologiques Les symptômes gastro-intestinaux étaient légèrement plus fréquents dans le groupe immunodéprimé avec une diminution de l’appétit, le seul symptôme statistiquement plus prévalent. Tableau Cinquante-sept Les patients ont eu des examens physiques complets documentés au diagnostic, et une tendance générale des anomalies d’examen physique a été observée plus dans le groupe non immunodéprimé, avec des anomalies pulmonaires en particulier statistiquement prévalentes Tableau Anomalies pulmonaires à l’examen étaient la constatation la plus commune% global Anomalies cardiaques ont été notées en% des patients, principalement constitués de tachycardie. Les autres anomalies étaient minimes et de nombreuses personnes n’avaient pas de résultats significatifs.

Tableau Résultats de l’examen physique Examens anormaux totaux% immunodéprimés% non immunodéprimés% P Valeur Rapport de cotes% cardiaque%% pulmonaire%%% ORL%%% peau%%% GI%%% Musculo-squelettique%%% neurologique%%% Ganglions lymphatiques%%% Extrémités%%% Examens totaux%%% Examens anormaux totaux% Immunodéprimés% Non immunodéprimés% P Valeur Rapport de cotes% cardiaque%% pulmonaire%%% ORL%%% peau%%% GI%%% Musculo-squelettique%%% neurologique%%% Ganglions lymphatiques%%% Extrémités%%% Total des examens%%% Les valeurs en gras indiquent une signification statistiqueAbbreviations: ORL, oreille, nez et gorge; GI, gastro-intestinalVoir Grand Tous les patients immunodéprimés ont nécessité une hospitalisation après diagnostic Six patients% dans le groupe immunodéprimé ont nécessité des soins intensifs et une ventilation mécanique. En revanche, seuls les patients%; P = du groupe non immunodéprimé nécessitant une hospitalisation et aucun nécessitant un traitement de soins intensifs P = Il y avait des décès observés dans le groupe immunodéprimé% Les patients immunodéprimés présentaient également une durée de maladie significativement plus longue P = avec une perte moyenne de jours, alors que les patients non immunocompromis observé pour perdre quelques jours

Figure Vue largeDétaillée viraleLongueur de l’excrétion virale Les patients ont été échantillonnés quotidiennement jusqu’à ce qu’ils présentent un test de diagnostic clinique négatif. Un nombre significativement plus long a été détecté dans le groupe immunodéprimé. Chaque point représente la longueur d’excrétion d’un patient individuel. Valeur P Les lignes pointillées représentent les jours immunodéprimés médians par rapport aux jours non immunodéprimés; Les patients ont été échantillonnés quotidiennement jusqu’à ce qu’ils présentent un test de diagnostic clinique négatif. Une excrétion significativement plus longue a été détectée dans le groupe immunodéprimé. Chaque point représente la longueur d’excrétion d’un patient. Les lignes pleines représentent les jours immunodéprimés moyens par rapport aux jours non immunocompromis. Valeur P Les lignes pointillées représentent les jours immunodéprimés médians par rapport aux jours non immunodéprimés; La radiographie thoracique était réalisée au moment du diagnostic des patients recrutés. Une majorité de patients immunodéprimés avaient des radiographies, tandis que moins de patients étaient des patients non immunodéprimés. Parmi ces examens radiologiques,% présentaient de nouvelles anomalies au moment du diagnostic. Les patients immunodéprimés étaient significativement plus susceptibles d’avoir de nouvelles anomalies d’imagerie avec% par rapport à% dans le groupe non immunocompromis. P = Les diagnostics viraux des patients recrutés sont résumés dans le tableau les souches de virus grippal A identifiées,% étaient des sous-types HN,% HN et% AHNpdm saisonniers Parmi les patients identifiés comme ayant une infection grippale A,% d’entre eux étaient infectés par un virus résistant à la neuraminidase ou développaient une résistance au cours de l’infection. et traitement Quand adamantane resi Le virus AHNpdm était le sous-type le plus répandu de la grippe. Le virus AHNpdm était le sous-type le plus répandu de la grippe. Un virus isolé%, et comme prévu, tous ces virus étaient résistants aux adamantanes comme les virus HN Tous les isolats HN saisonniers identifiés contenaient la mutation de résistance HY NAI conférant une résistance à l’oseltamivir et éventuellement au péramivir Cette mutation a été constatée à le moment de l’identification initiale du virus et est resté stable dans tous les isolats consécutifs prélevés chez ces patients

Caractéristiques des types de virus identifiés Sous-type Immunodéprimés Non immunosupprimés Total Influenza A% AHNpdm% HN saisonnier% HN saisonnier% Influenza B% Sous-type non identifié% Co-infection VRS, coronavirus% Type Sous-type Immunodéprimés Non immunosupprimés Total Influenza A% AHNpdm% HN saisonnière% HN saisonnière Influenza B % RSV, coronavirus% Abréviation: RSV, virus respiratoire syncytialAHNpdm: patients développés HYSeasonal HN:% résistance HYSeasonal HN: patient avec mutation par deletionView LargeTrois patients immunodéprimés ont été infectés par des virus grippaux qui ont développé une résistance aux inhibiteurs de neuraminidase pendant le traitement Un patient avec un L’infection à HN a développé une nouvelle mutation par délétion dans le gène NA. Les autres cas étaient des infections à AHNpdm qui ont développé des mutations HY. Dans tous ces cas, les mutations sont survenues après traitement par oseltamivir et dans un cas par peramivir au cours d’une évolution clinique prolongée La réponse cytokinique lors d’une infection aiguë a été mesurée à la fois par les lavages sériques et nasaux des cytokines IL-, IL-, TNF- L’α, le G-CSF, le GM-CSF, le MCP et le MIP-b se sont avérés être élevés dans le sérum et / ou le lavage nasal comparés aux témoins pendant l’infection. Figures et Globalement, aucune différence significative n’a été notée dans ces réponses entre les immunodéprimés et les groupes non immunodéprimés

Figure View largeTélécharger les niveaux de cytokines détectés dans le lavage nasal Dix-sept cytokines ont été mesurées dans les lavages nasaux, et représentées ici étaient élevées par rapport aux témoins sains. Les barres d’erreur représentent l’erreur standard de la moyenne. ont été mesurés dans les lavages nasaux, et les représentés ici ont été élevés par rapport à une moyenne de contrôles sains Les barres d’erreur représentent l’erreur standard de la moyenne

Figure Vue largeDownload diapositivesCytokines détectées dans le sérum Dix-sept cytokines ont été mesurées dans le sérum, et les représentés ici ont été élevés par rapport à un moyen de contrôles sains Les barres d’erreur représentent l’erreur standard de la moyenne. et les représentés ici ont été élevés par rapport à une moyenne de contrôles sains Les barres d’erreur représentent l’erreur standard de la moyenne

DISCUSSION

les patients étaient asymptomatiques pendant une partie du temps où ils étaient infectés, la plupart présentaient des symptômes typiques de la grippe durant les premiers jours d’infection. Ceci était cohérent avec les mesures de cytokines observées, car la réponse immunitaire innée aiguë est probablement principalement responsable de Les élévations des cytokines étaient en accord avec ce qui a été rapporté précédemment lors d’une infection grippale . Dans le sérum, des élévations similaires ont été notées dans les deux groupes, bien que dans un groupe de patients immunodéprimés et non immunodéprimés. En dépit de la similitude de la réponse innée aiguë entre les groupes, des différences importantes ont été notées dans les symptômes globaux entre les groupes immunodéprimés et non immunodéprimés. Moins de symptômes globaux ont été notés dans le groupe immunodéprimé, et tous les cas de grippe les symptômes étaient plus fréquents dans le groupe non immunocompromis, à l’exception des symptômes gastro-intestinaux, qui étaient probablement liés à des maladies sous-jacentes ou thérapeutiques, car plusieurs de ces individus immunodéprimés souffraient de GVHD dans l’intestin ou recevaient un agent chimiothérapeutique toxique. les symptômes systémiques sont survenus plus souvent dans le groupe non immunodéprimé, ce qui suggère que même si la réponse immunitaire innée est similaire, les manifestations cliniques peuvent ne pas l’être et la possibilité d’une maladie émoussée doit être prise en compte lors de l’évaluation des patients immunodéprimés. nombre d’anomalies radiographiques ont été notées dans le groupe immunodéprimé, indiquant leur risque accru d’atteinte pulmonaire et de complications. Ces modifications radiologiques étaient souvent en l’absence d’anomalies pulmonaires à l’examen physique, qui étaient plus fréquentes dans le groupe non immunocompromis. Il est important de considérer cliniquement que la présence ou l’absence de symptômes et de signes peuvent ne pas être des indicateurs adéquats de la maladie, en particulier chez les personnes immunodéprimées qui présentent un risque plus élevé de pneumonie, d’infections bactériennes secondaires et d’autres complications pulmonaires. Infection grippale et ses complications Dans cette étude, environ un% des personnes recrutées avaient été vaccinées au cours de l’année précédant l’infection, mais elles étaient encore atteintes de la grippe. Un plus grand nombre de non immunocompromis ont été vaccinés contre seulement cette observation est d’autant plus préoccupante qu’un nombre important d’individus immunocompétents a été infecté malgré un vaccin qui correspondait étroitement au virus infectant. Les observations de vaccination faites dans cette étude sont en accord avec les observations récentes des CDC qui ont démontré l’efficacité du vaccin antigrippal ces dernières années. Les vaccins antigrippaux ont manifestement une efficacité variable difficile à prédire, en particulier lorsque l’on tient compte des virus émergents et des populations particulières. Cela souligne que des travaux supplémentaires doivent être entrepris pour trouver de nouveaux vaccins / vaccins. stratégies de prévention visant à réduire la charge de morbidité dans la population générale en bonne santé et en particulier chez les populations particulièrement immunodéprimées, où la vaccination est encore entravée par l’incapacité de l’hôte à réagir. Cela peut nécessiter de reconsidérer la prévention de la maladie comme un objectif. Dans les cas où les vaccins ne préviennent pas l’infection ou ne sont pas administrés, la dernière étape de la prévention de la morbidité et de la mortalité de la grippe est le traitement thérapeutique, dont les antiviraux. sont l’étalon-or actuel La prévalence Conformément aux observations récentes, tous les virus grippaux identifiés dans cette étude étaient résistants à au moins une classe d’antiviraux. Dans ce groupe de patients,% des virus étaient résistants. Les deux principales classes d’antiviraux, y compris certains isolats de HN et AHNpdm La plupart de ces virus ont été identifiés chez des patients immunodéprimés après avoir reçu des traitements prolongés au-delà des jours de traitement antiviral. Ces données concordent avec les observations que ces virus sont transmissibles et non atténués chez l’animal. Les modèles suggèrent que le développement de la multirésistance est une préoccupation majeure et que les patients immunodéprimés peuvent être à risque d’être les hôtes du développement et de la propagation de la résistance dans la communauté. Recherche supplémentaire, développement de nouvelles thérapies et réévaluation de la individus immunodéprimés sont traités pour la grippe devrait être entrepris

CONCLUSION

L’étude de l’histoire naturelle de la grippe est extrêmement difficile car dans presque tous les cas il est impossible d’identifier exactement quand un patient était infecté. Bien qu’une cohorte relativement petite ait été observée dans cette étude, c’est l’une des plus grandes cohortes d’individus gravement immunodéprimés. La comparaison de ces individus avec des individus non immunocompromis lors d’une infection grippale a démontré que les patients immunodéprimés sont à risque d’une maladie plus grave ou compliquée, qui peut être difficile à prévenir avec les vaccins actuels et traiter avec les antiviraux actuels. la prise en charge d’hôtes sévèrement immunodéprimés comprend le développement d’une excrétion asymptomatique qui pourrait augmenter le risque de transmission, le développement d’une multirésistance lors d’un traitement antiviral prolongé et le risque élevé d’atteinte pulmonaire de leur maladie entraînant des infections secondaires ou des complications. cationsUne meilleure compréhension de la pathogénie humaine de base de la grippe sera nécessaire si nous voulons aborder la prévention et le traitement de la grippe de manière plus individualisée, en particulier pour les immunodéprimés. Il est clair que les antiviraux actuels ne sont pas adaptés en toutes circonstances. les stratégies vaccinales doivent être améliorées, et une évaluation minutieuse de chaque cas individuel peut être nécessaire pour adapter le traitement et la prévention non seulement aux personnes gravement immunodéprimées, mais probablement à celles d’autres populations importantes à risque.

Remarques

Remerciements Les auteurs aimeraient remercier Maryna Eichelberger, Division des produits viraux, Centre d’évaluation et de recherche en biologie, Food and Drug Administration pour sa contribution à la préparation de cet article. Soutien financier Ce travail a été soutenu par le programme de recherche intra-muros du National Institute of Allergy Dr Memoli était le scientifique principal pour ce travail menant tous les aspects comprenant la conception, la mise en application de protocole clinique, les études de laboratoire, et l’analyse de données / préparation de manuscrit. Conflits d’intérêt potentiels Tous les auteurs: Aucun conflit signalé Tous les auteurs ont soumis le ICMJE Form for Disclosure of Conflits d’intérêts potentiels Les conflits que les éditeurs jugent pertinents pour le contenu du manuscrit ont été divulgués