Herpesvirus humains et syndrome de fatigue chronique: une étude cas-témoins

Nous avons mené cette étude pour déterminer si l’infection par l’herpèsvirus HHV A, HHV-B ou HHV différait entre les patients atteints de syndrome de fatigue chronique et les sujets témoins. à HHV-, et tous étaient séropositifs Les spécimens lymphocytaires ont été co-cultivés avec des lymphocytes du sang de cordon et testés pour HHV- et HHV-; Enfin, les lymphocytes ont été testés en utilisant des méthodes de réaction en chaîne par polymérase pour l’ADN HHV-A, HHV-B et HHV-. L’ADN HHV-A ou HHV-B a été détecté en% des échantillons, et il n’y avait pas de différences significatives par des analyses appariées entre les patients [%] et les sujets témoins [%] d’ADN HHV ont été détectés chez les sujets, et bien que les sujets témoins [%] étaient plus susceptibles que les patients [%] d’être positifs, la différence n’était pas statistiquement significative. trouvé aucune preuve que l’infection active ou latente avec HHV-A, HHV-B, HHV- ou toute combinaison de ces HHV est associée au syndrome de fatigue chronique

Syndrome de fatigue chronique Le syndrome de fatigue chronique se caractérise par une fatigue débilitante qui dure pendant ≥ mois et s’accompagne de symptômes tels que troubles neurocognitifs, douleurs musculo-squelettiques, maux de gorge et lymphadénite Aucun signe physique ou test de diagnostic ne peut confirmer le syndrome. les patients atteints du SFC signalent une maladie pseudo-grippale juste avant l’apparition du SFC, et il est possible que le SFC ou un sous-ensemble de SFC soit associé à une infection virale L’herpèsvirus humain HHV et HHV- ont été suggérés comme causes possibles de SSCHV. a été décrite dans , et l’existence des variants HHV-A et HHV-B a été documentée dans HHV- a été décrite dans HHV-A, HHV-B, et HHV- sont des membres du genre Roseolovirus dans le sous-famille Betaherpesvirinae Les virus partagent un trophisme cellulaire similaire et peuvent infecter les lymphocytes T CD et les glandes salivaires in vivo Les résultats d’études séro-épidémiologiques ont montré de façon constante que jusqu’à% des enfants sont infectés. d avec HHV- par mois d’âge et que%% de la population âgée & gt; ans est séropositif Environ% des enfants sont infectés par le VHH- dans les premières années de la vie, généralement entre les âges des mois et des années De la population adulte, ~% est séropositif pour l’HHV- HHV-B provoque l’exanthème subitum roseola Le spectre clinique des infections à HHV-A et HHV chez les enfants n’est pas bien décrit, et les associations causales avec la maladie chez les adultes restent spéculatives car la plupart des personnes ont été infectées par le HHV- et le HHV- chez les enfants. La réactivation des infections latentes peut précipiter le SFC ou plus probablement refléter une pathophysiologie sous-jacente. Ces virus sont activés chez les hôtes immunodéprimés, les receveurs de greffe rénale et la moelle osseuse. -transplantées et chez les patients atteints de diverses maladies lymphoprolifératives Des études sur le HHV et le CFS ont donné des résultats contradictoires. s incohérence reflète divers degrés de rigueur dans la définition des patients et la sélection des sujets témoins appropriés, un manque de normes unifiées pour définir et sous-catégoriser les patients avec CFS en termes de type de début, durée de la maladie ou état clinique actuel et incapacité à différencier HHV-A, HHV-B et HHV- sérologiquement ou par détection virale L’objectif de cette étude était d’utiliser des tests sensibles pour examiner les échantillons de lymphocytes afin de déterminer si l’infection par HHV-A, HHV-B ou HHV différait entre les patients avec CFS et sujets témoins

Sujets et méthodes

cultures de lymphocytes du sang de cordon stimulées par la phytohémagglutinine et ont été passées dans des lymphocytes indépendants du sang de cordon frais à des intervalles de semaines pendant des semaines pour un effet cytopathogène et pour la présence d’antigènes HHV et HHV avec des anticorps monoclonaux spécifiques. ] Après des semaines, les cultures ont également été testées pour l’ADN HHV-A, HHV-B et HHV- au moyen d’une amplification par PCR. Amplification de la PCR Frozen Les lymphocytes étaient disponibles chez tous les patients et chez des sujets témoins appariés et ont été analysés par PCR pour l’ADN HHV-A, HHV-B et HHV-. Pour chaque sujet, des cellules ont été mises en suspension dans des ul de tampon de lyse. Tris [pH], et μg de protéinase K / mL dans l’eau, chauffée à ° C pendant h, et transférée à un bloc de chaleur ° C pendant min En général, des aliquotes de cellules μL de cellules du lysat cellulaire ont été utilisées pour l’amplification PCR de HHV-A, HHV-B et H HV-; des ensembles d’amorces spécifiques pour chaque virus ont été utilisés. Les réactions consistaient en pH Tris-HCl mM; KCl mM; mM MgCl; % en poids / volume de gélatine GeneAmp PCR Buffer, PE Biosystems, Norwalk, CT; μM chacun de dATP, dCTP, dGTP et dTTP Roche Molecular Biochemicals, Indianapolis, IN; et l’ADN polymerase U Taq AmpliTaq Gold, PE Biosystems Primers ont été utilisés à une concentration finale de μM chaque test de PCR d’amorce interceptée pour HHV- Cette méthode a utilisé un test de PCR nested basé sur des séquences d’amorces situées dans le gène tégument. Les conditions de cyclage pour les amorces externes, SIE et SIE, consistaient en une dénaturation initiale à ° C pendant min, suivie d’une dénaturation à ° C pendant min et par des cycles de dénaturation à ° C pendant min, recuit. à ° C pour min, extension à ° C pour min, et extension finale à ° C pour min amplification commune avec les amorces SIE et SIE aboutit à un produit -bp PCR Nested test a ensuite été fait avec l’utilisation de μL du produit susmentionné avec les paramètres suivants: L’ADN de HHV-A a été amplifié en utilisant les amorces LTP-A et LTP-A, ce qui a donné un produit -bp, et l’ADN de HHV-B a été amplifié en utilisant les amorces LTP-B et LTP-B produit Variante A paramètre de cyclage On a procédé à une dénaturation initiale à ° C pendant min, suivie d’une dénaturation à ° C pendant min, de cycles de dénaturation à ° C pendant min, d’annelage à ° C pendant min, d’extension à ° C pendant min et d’extension finale à ° C pour Les conditions de cyclage de la variante B étaient les mêmes que celles de la variante A, à l’exception du recuit à ° C et de l’extension au test CPCR ° pour le gène HHV- immédiat-précoce Nous avons utilisé un test PCR non-fondé basé sur les séquences amorce du HHV- Les amorces ont été utilisées pour encadrer une délétion spécifique à un variant Après la dénaturation initiale à ° C pendant min, les conditions de cycle étaient les mêmes que celles décrites précédemment. Dosage du PCR pour HHV- Des amorces ont été utilisées pour générer un produit amplifié par bp. Après la dénaturation initiale à ° C pendant min, les conditions de cyclage étaient les mêmes que celles décrites précédemment Hybridation par transfert de Southern Les gels ont été transférés de manière unidirectionnelle sur des membranes de Nytran Schleicher & amp; Schuell, Keene, NH et ont été hybridées avec la sonde appropriée marquée avec le kit de marquage P Random Prime, Roche Molecular Biochemicals solution d’hybridation se compose de × SSC,% pyrophosphate de sodium, μg d’héparine / mL,% SDS, et% réactif de blocage Roche Molecular Biochemicals Après une nuit d’hybridation à ° C, les membranes ont été lavées 1 fois par minute à température ambiante avec du SSC et du SDS puis lavées pendant h à ° C avec du SSC et des membranes SDS ont été exposées au film Kodak X-Omat AR Eastman Kodak Scientific Imaging, New Haven, CT à – ° C pour h avec intensification des écransDes gabarits double brin pour la préparation des sondes qui manquaient les séquences d’amorces utilisées dans l’analyse PCR diagnostique ont été générés par un test PCR avec les amorces suivantes: pour l’ensemble d’amorces décrit par Cone et al , TTTATGAACTACGATCACA et GAATCTTGTAAGTATATGG; pour les ensembles d’amorces décrits par Yamamoto et al , CAAACAAACCCTAACTGTGTA et GTCCCTTCAACTACTGAATCG pour une sonde HHV-A et CAAACAAGCCCTAACTGTGTA et GTCTCTACAACTACTGAGTCG pour une sonde HHV-B, ces sondes ont été mélangées pendant l’hybridation; et pour l’ensemble d’amorces HHV- décrit par Berneman et al , ACCAATTCAGTTTTCATCC et TAACAATTTGAAGAGGAGA Les conditions de cycle pour toutes les analyses étaient les suivantes: dénaturation initiale à ° C pendant min, suivie de cycles à ° C pour min, ° C pour min et ° C pour minStatistical analysis Le test de Cochran-Mantel-Haenzel a été utilisé pour prendre en compte la caractéristique d’appariement de la conception et pour permettre un nombre inégal de sujets témoins par patient patient. Nous n’avons pas comparé les patients avec des sujets témoins. , la proportion de résultats positifs était de & lt;% Les comparaisons des résultats inclus dans les groupes, la proportion totale de résultats positifs et la valeur de P P ≤ ont été considérées comme significatives

Résultats

Sérologie Comme décrit ailleurs , tous les patients et sujets témoins étaient séropositifs pour HHV- Le titre médian d’anticorps anti-HHV était pour les patients et pour les sujets témoins. Cette différence n’était pas significative. Isolement du virus Ni HHV ni HHV- ont été isolés des lymphocytes du sang périphérique de patients ou de sujets témoins; Aucune culture n’a développé d’effet cytopathogène, ni l’anticorps monoclonal ni le test PCR des cultures n’ont révélé d’infection par le HHV. Détection de HHV-A, HHV-B et HHV- par analyse PCR Bien que toutes les analyses aient été appariées, les Le test PCR a détecté l’ADN HHV-A ou HHV-B chez des sujets, et il n’y avait pas de différence significative dans la distribution de l’infection mono-typique avec HHV-A ou HHV-B ou double HHV-A / HHV-B entre patients Le test PCR nichée a détecté l’ADN HHV-A chez% des sujets et l’ADN HHV-B chez% de ces sujets L’ADN HHV-B a également été détecté chez le sujet infecté par le HHV-A contamination. Le test PCR du HHV- immédiat ADN-H détecté chez des patients supplémentaires HHV-A chez les patients et HHV-B chez HHV-ADN a été détecté chez% des sujets Encore une fois, les sujets témoins [%] étaient plus susceptibles que les patients [%] d’être positifs, mais la différence n’était pas statistiquement significatif dans les analyses appariées Trois sujets En raison des similitudes biologiques entre HHV et HHV, et parce que peu d’infections doubles ont été détectées, nous avons examiné la détection de l’ADN du HHV ou du HHV par l’une des méthodes de PCR. significativement plus de sujets témoins [%] que de patients [%] étaient positifs P = Cette distribution était similaire lorsque les données étaient stratifiées selon le type d’apparition du SFC, le score de bien-être ou les données d’âge non montrées

Discussion

Le temps par hasard Les patients auraient répondu à la définition de cas de CFS ; Cependant, parmi les patients dont l’HHV était isolé, la dysfonction cérébrale sévère et la polylymphadénopathie sévère étaient importantes, et la troisième était une infection aiguë par le virus Epstein-Barr. Les patients avaient probablement des maladies autres que le SCF. Malheureusement, cette étude ne caractérisait pas la fatigue ou classifiaient les patients selon des critères standards, et les chercheurs ne rapportaient pas systématiquement l’évaluation des patients pour prendre en compte les causes connues de fatigue chronique. , l’étude n’a pas caractérisé les sujets témoins; Il est donc impossible d’évaluer de manière critique les résultats. De plus, l’étude n’a pas présenté d’analyses statistiques pour élucider les différences observées, n’a pas abordé les interactions possibles entre les facteurs de risque et n’a pas contrôlé les variables confondantes possibles. infection La première étude a inclus des patients atteints de SFC et des sujets sains appariés selon l’âge Tous les sujets étaient séropositifs pour HHV-, et HHV- n’a pu être détecté en culture directe de PBMC chez aucun sujet. ADN dans% de patients comparé à aucun sujet témoin Test exact de Fisher; P Malheureusement, aucune information n’a été fournie concernant les patients, sauf qu’ils répondaient à la définition de cas de CFS , et aucune information n’a été fournie concernant les sujets témoins, sauf qu’ils étaient en bonne santé et appariés en fonction de l’âge. Enfin, l’étude a été menée au Japon et les résultats ne peuvent pas être généralisés à d’autres populations raciales / ethniques. Une étude italienne moins approfondie de patients atteints de SFC et de sujets témoins a trouvé l’ADN HHV dans les PBMC à partir de % des patients et% des sujets témoins χ test; P HHV-B a été trouvé dans% de patients et% de sujets de contrôle, et HHV-A a été trouvé dans% de patients et% de sujets de contrôle Test exact de Fisher, P Ainsi, les différences observées n’étaient pas statistiquement significatives HHV- ADN a été détecté chez% des patients et% des sujets témoins Les patients n’ont pas été décrits, sauf qu’ils répondaient à la définition de cas de CFS Les sujets témoins étaient des donneurs de sang sains non sélectionnés provenant de la même région géographique que le Cette étude n’a pas pu être réalisée avec les patients et les sujets témoins. L’étude la plus récente a inclus des patients atteints de SFC et de sujets témoins Tous les sujets étaient séropositifs pour le HHV-, et la culture directe des PBMC n’était pas ADN HHV- a été détecté chez% des patients et% de sujets témoins, et HHV-ADN a été détecté chez% des patients et% des sujets témoins Les patients ont rencontré la définition de cas de CFS et ont été bien décrits. les sujets témoins étaient médecins ou auto-référés et représentaient donc un échantillon de commodité; Par conséquent, il est impossible d’évaluer de façon critique la signification de leurs résultats par rapport à ceux des patients. Enfin, les études qui ne mesuraient pas l’infection à HHV active ou qui ne testaient pas l’ADN, donnaient des données sérologiques sur le HHV pour les patients atteints de SFC et les sujets témoins. Une excellente étude a mesuré aveuglément les anticorps IgG et IgM dirigés contre l’antigène précoce HHV chez des patients bien caractérisés atteints de SFC provenant de pratiques cliniques et de donneurs de sang sains provenant des mêmes régions . Les chercheurs ont trouvé que% des patients et% Les sujets témoins présentaient des anticorps IgG dirigés contre l’antigène précoce HHV et un pourcentage de patients et% de sujets témoins avaient un anticorps IgM. Une seconde étude, sérieusement défectueuse, a mesuré des anticorps dirigés contre des souches de HHV dans des échantillons sériques chez des patients âgés de années, qui ont été recrutés à partir du personnel des laboratoires de l’Institut national japonais de la santé Shinjuku-ku, au Japon et à l’Université du Massachusetts Medica l École Worcester, MA Bien que significativement plus de patients que de sujets témoins étaient séropositifs et avaient des titres moyens géométriques plus élevés d’anticorps, les groupes sont inappropriés pour la comparaison épidémiologique. En résumé, nous n’avons trouvé aucune association entre CFS et HHV-A, HHV-B ou HHV- dans un groupe de patients bien caractérisés et rigoureusement définis avec SCF et sujets témoins appariés choisis au hasard L’infection primaire avec HHV- ou HHV- n’est pas susceptible d’être causalement associée à CFS, parce que l’infection est pratiquement omniprésente à l’âge de – années En outre, il est peu probable que la réactivation de HHV- ou HHV- latent soit causalement associée à une proportion substantielle de cas de CFS en raison du manque de consensus entre les études et parce que la réactivation de la plupart des herpèsvirus latents est fréquente et sporadique. habituellement asymptomatique

Remerciements

Nous tenons à remercier Kathleen Kite-Powell et Joanne Patton, qui ont effectué l’isolement du virus et les tests sérologiques. Nous reconnaissons également la contribution de Jessalyn Salter, qui a aidé à compiler les données et les références